Sequence Analysis in a Nutshell: A Guide to Common Tools and Databases

primersearch

primersearch reads in primer pairs from an input file and searches them against sequence(s) specified by the user. Each of the primers in a pair is searched against the sequence, and potential amplimers are reported.

Here is a sample session with primersearch:

% primersearch embl:Z52466 Searches DNA sequences for matches with primer pairs Primer file: primers Output file [hsa203yc1.primersearch]: stdout Allowed percent mismatch [0]: Primer name D1S243 Primer name D1S468 Primer name D1S2845 Primer name D1S1608 Primer name D1S2893 Primer name D1S2660 Amplimer 1 Sequence: HSA203YC1 Z52466 H.sapiens (D1S2660) DNA segment containing (CA) repeat; clone AFMa203yc1; single read. CACACATGCACATGCAC hits forward strand at 27 with 0 mismatches AGTGACACCAGCAGGG hits reverse strand at [103] with 0 mismatches Amplimer length: 261 bp

Here we run the same example, but allow a 20% mismatch between the primers and the sequence:

unix % primersearch embl:Z52466 Searches DNA sequences for matches with primer pairs Primer file: primers Output file [hsa203yc1.primersearch]: stdout Allowed percent mismatch [0]: 20 Primer name D1S243 Primer name D1S468 Primer name D1S2845 Primer name D1S1608 Primer name D1S2893 Primer name D1S2660 Amplimer 1 Sequence: HSA203YC1 Z52466 H.sapiens (D1S2660) DNA segment containing (CA) repeat; clone AFMa203yc1; single read. CACACATGCACATGCAC hits forward strand at 49 with 2 mismatches AGTGACACCAGCAGGG hits reverse strand at [103] with 0 mismatches Amplimer length: 239 bp Amplimer 2 Sequence: HSA203YC1 Z52466 H.sapiens (D1S2660) DNA segment containing (CA) repeat; clone AFMa203yc1; single read. CACACATGCACATGCAC hits forward strand at 27 with 0 mismatches AGTGACACCAGCAGGG hits reverse strand at [103] with 0 mismatches Amplimer length: 261 bp

Here is an example of running with a file containing a list of sequences.

% primersearch @seqs.list Searches DNA sequences for matches with primer pairs Primer file: primers Output file [hs214yg7.primersearch]: stdout Allowed percent mismatch [0]: Primer name D1S243 Amplimer 1 Sequence: HS214YG7 Z16979 H. sapiens (D1S243) DNA segment containing (CA) repeat; clone AFM214yg7; single read. CACACAGGCTCACATGCC hits forward strand at 122 with 0 mismatches GCTCCAGCGTCATGGACT hits reverse strand at [36] with 0 mismatches Amplimer length: 162 bp Primer name D1S468 Amplimer 1 Sequence: HS280WE5 Z23994 H. sapiens (D1S468) DNA segment containing (CA) repeat; clone AFM280we5; single read. AATTAACCGTTTTGGTCCT hits forward strand at 47 with 0 mismatches GCGACACACACTTCCC hits reverse strand at [96] with 0 mismatches Amplimer length: 185 bp Primer name D1S2845 Amplimer 1 Sequence: HS344WE9 Z51474 H.sapiens (D1S2845) DNA segment containing (CA) repeat; clone AFM344we9; single read. CCAAAGGGTGCTTCTC hits forward strand at 29 with 0 mismatches GTGGCATTCCAACCTC hits reverse strand at [157] with 0 mismatches Amplimer length: 201 bp Primer name D1S1608 Amplimer 1 Sequence: HS829186 G07829 human STS CHLC.GATA49A06.P15262 clone GATA49A06, sequence tagged site. GATGGCTTTTGGGGACTATT hits forward strand at 13 with 0 mismatches CACTGAGCCAAGTGACACAG hits reverse strand at [92] with 0 mismatches Amplimer length: 270 bp Primer name D1S2893 Amplimer 1 Sequence: HS123XC3 Z50993 H.sapiens (D1S2893) DNA segment containing (CA) repeat; clone AFM123xc3; single read. AAAACATCAACTCTCCCCTG hits forward strand at 5 with 0 mismatches CTCAAACCCCAATAAGCCTT hits reverse strand at [3] with 0 mismatches Amplimer length: 215 bp Primer name D1S2660 Amplimer 1 Sequence: HSA203YC1 Z52466 H.sapiens (D1S2660) DNA segment containing (CA) repeat; clone AFMa203yc1; single read. CACACATGCACATGCAC hits forward strand at 27 with 0 mismatches AGTGACACCAGCAGGG hits reverse strand at [103] with 0 mismatches Amplimer length: 261 bp

Mandatory qualifiers:

[-sequences] (seqall)

Sequence database USA.

[-primers] (infile)

Primer file.

[-mismatchpercent] (integer)

Allowed percent mismatch.

[-out] (outfile)

Output filename .

Категории